* Biology Meets Programming: Bioinformatics for Beginners ** Week 1 *** DNA replication **** Origin of replication (ori) Locating an ori is key for gene therapy (e.g. viral vectors), to introduce a theraupetic gene. **** Computational approaches to find ori in Vibrio Cholerae ***** Exercise: find Pattern We'll look for the *DnaA box* sequence, using a sliding window, in that case we will use the function [[./Code/PatternCount.py][PatternCount]] to find out how many times does a sequence appear in the genome. For the second part, we're going to calculate the frequency map of the sequences of length /k/, for that purpose we'll use [[./Code/FrequentWords.py][FrequentWords]] ***** Exercise: Find the reverse complement of a sequence We're going to generate the reverse complement of a sequence, which is the complement of a sequence, read in the same direction (5' -> 3'). In this case, we're going to use [[./Code/ReverseComplement.py][ReverseComplement]] After using our function on the /Vibrio Cholerae's/ genome, we realize that some of the frequent /k-mers/ are reverse complements of other frequent ones. ***** Exercise: Find a subsequence within a sequence We're going to find the ocurrences of a subsquence inside a sequence, and save the index of the first letter in the sequence. This time, we'll use [[./Code/PatternMatching.py][PatternMatching]] After using our function on the /Vibrio Cholerae's/ genome, we find out that the /9-mers/ with the highest frequency appear in cluster. This is strong statistical evidence that our subsequences are /DnaA boxes/. **** Computational approaches to find ori in any bacteria Now that we're pretty confident about the /DnaA boxes/ sequences that we found, we are going to check if they are a common pattern in the rest of bacterias. We're going to find the ocurrences of the sequences in /Thermotoga petrophila/ using [[./Code/PatternCount.py][PatternCount]] After the execution, we observe that there are *no* ocurrences of the sequences found in /Vibrio Cholerae/. We can conclude that different bacterias have different /DnaA boxes/. We have to try another computational approach then, find clusters of /k-mers/ repeated in a small interval. ** Week 2 *** DNA replication (II) **** Replication process The /DNA polymerases/ start replicating while the parent strands are unraveling. On the lagging strand, the DNA polymerase waits until the replication fork opens around 2000 nucleotides, and because of that it forms Okazaki fragments. We need 1 primer for the leading strand and 1 primer per Okazaki fragment for the lagging strand. While the Okazaki fragments are being synthetized, a /DNA ligase/ starts joining the fragments together. **** Computational approach to find ori using deamination As the lagging strand is always waiting for the helicase to go forward, the lagging strand is mostly in single-stranded configuration, which is more prone to mutations. One frequent form of mutation is *deamination*, a process that causes cytosine to convert into thymine. This means that cytosine is more frequent in half of the genome. ***** Exercise: count the ocurrences of cytosine We're going to count the ocurrences of the bases in a genome and include them in a symbol array, for that purpose we'll use [[./Code/SymbolArray.py][SymbolArray]] After executing the program, we realize that the algorithm is too inefficient. ***** Exercise: find a better algorithm for the previous exercise This time, we are going to evaluate an element /i+1/, using the element /i/. We'll use [[./Code/FasterSymbolArray.py][FasterSymbolArray]] to achieve this After executing the program we see that it's a viable algorithm, with a complexity of /O(n)/ instead of the previous /O(n²)/. In /Escherichia Coli/ we plotted the result of our program: #+CAPTION: Symbol array for Cytosine in E. Coli Genome] [[./Assets/e-coli.png]] From that graph, we conclude that ori is located around position 4000000, because that's where the Cytosine concentration is the lowest, which indicates that the region stays single-stranded for the longest time. **** The Skew Diagram Usually scientists measure the difference between /G - C/, which is *higher on the lagging strand* and *lower on the leading strand*. ***** Exercise: Synthetize a Skew Array We're going to make a Skew Diagram, for that we'll first need a Skew Array. For that purpose we wrote [[./Code/SkewArray.py][SkewArray]] We can see the utility of a Skew Diagram looking at the one from /Escherichia Coli/: #+CAPTION: Symbol array for Cytosine in E. Coli Genome] [[./Assets/skew_diagram.png]] Ori should be located where the skew is at its minimum value. ***** Exercise: Efficient algorithm for locating ori Now that we know more about ori's skew value, we're going to construct a better algorithm to find it. We'll do that in [[./Code/MinimumSkew.py][MinimumSkew]] **** Finding /DnaA boxes/ When we look for /DnaA boxes/ in the minimal skew region, we can't find highly repeated /9-mers/ in /Escherichia Coli/. But we find approximate sequences that are similar to our /9-mers/ and only differ in 1 nucleotide. ***** Exercise: Calculate Hamming distance The Hamming distance is the number of mismatches between 2 strings, we'll solve this problem in [[./Code/HammingDistance][HammingDistance]] ***** Exercise: Find approximate patterns Now that we have our Hamming distance, we have to find the approximate sequences. We'll do this in [[./Code/ApproximatePatternMatching.py][ApproximatePatternMatching.py]] ***** Exercise: Count the approximate patterns The final part is counting the approximate sequences, for that we'll use [[./Code/ApproximatePatternCount.py][ApproximatePatternCount.py]] After trying out our ApproximatePatternCount in the hypothesized ori region, we find a frequent /k-mer/ with its reverse complement in /Escherichia Coli/. We've finally found a computational method to find ori that seems correct. ** Week 3 *** The circadian clock Variation in gene expression permits the cell to keep track of time. **** Computational approaches to find regulatory motifs ***** Exercise: Find the most common nucleotides in each position We are going to create a *t x k* Motif Matrix, where *t* is the /k-mer/ string. In each position, we'll insert the most frequent nucleotide, in upper case, and the nucleotide in lower case (if there's no popular one). Our goal is to select the *most* conserved Matrix, i.e. the Matrix with the most upper case letters. We'll use a *4 x k* Count Matrix, one row for each base. We'll first generate the Matrix: #+BEGIN_SRC python def Count(Motifs): k = len(Motifs[0]) count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k} t = len(Motifs) for i in range(t): for j in range(k): symbol = Motifs[i][j] count[symbol][j] += 1 return count #+END_SRC Now that we have a Count Matrix, we will generate a Profile Matrix, which has the frequency of the nucleotide instead of the count: #+BEGIN_SRC python def Profile(Motifs): t = len(Motifs) profile = Count(Motifs) for key, v in profile.items(): v[:] = [x / t for x in v] return profile def Count(Motifs): k = len(Motifs[0]) count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k} t = len(Motifs) for i in range(t): for j in range(k): symbol = Motifs[i][j] count[symbol][j] += 1 return count #+END_SRC ***** Exercise: Form the most frequent sequence of nucleotides Finally, we can form a Consensus string, to get a candidate regulatory motif: #+BEGIN_SRC python def Consensus(Motifs): consensus = "" count = Count(Motifs) k = len(Motifs[0]) for j in range(k): m = 0 frequentSymbol = "" for symbol in "ACGT": if count[symbol][j] > m: m = count[symbol][j] frequentSymbol = symbol consensus += frequentSymbol return consensus def Count(Motifs): k = len(Motifs[0]) count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k} t = len(Motifs) for i in range(t): for j in range(k): symbol = Motifs[i][j] count[symbol][j] += 1 return count #+END_SRC After obtaining the Consensus string, all we need to do is obtains the total score of our selected /k-mers/: #+BEGIN_SRC python def Score(Motifs): score = 0 for i in range(len(Motifs)): score += HammingDistance(Motifs[i], Consensus(Motifs)) return score def Consensus(Motifs): consensus = "" count = Count(Motifs) k = len(Motifs[0]) for j in range(k): m = 0 frequentSymbol = "" for symbol in "ACGT": if count[symbol][j] > m: m = count[symbol][j] frequentSymbol = symbol consensus += frequentSymbol return consensus def Count(Motifs): k = len(Motifs[0]) count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k} t = len(Motifs) for i in range(t): for j in range(k): symbol = Motifs[i][j] count[symbol][j] += 1 return count def HammingDistance(p, q): count = 0 for i in range(0, len(p)): if p[i] != q[i]: count += 1 return count #+END_SRC ***** Exercise: Find a set of /k-mers/ that minimize the score Applying a brute force approach for this task is not viable, we'll use a Greedy Algorithm. For that, we'll first determine the probability of a sequence, we'll use: #+BEGIN_SRC python def Pr(Text, Profile): probability = 1 k = len(Text) for i in range(k): probability *= Profile[Text[i]][i] return probability #+END_SRC We'll use this function to find the most probable /k-mer/ in a sequence: #+BEGIN_SRC python def ProfileMostProbableKmer(text, k, profile): kmer = "" keys = ["A", "C", "G", "T"] d = dict(zip(keys,profile)) prob = -1 for i in range(len(text)-k+1): if (Pr((text[i:i+k]), profile) > prob): prob = Pr(text[i:i+k], profile) kmer = text[i:i+k] return kmer def Pr(Text, Profile): probability = 1 k = len(Text) for i in range(k): probability *= Profile[Text[i]][i] return probability #+END_SRC Now we're finally ready to assemble all the pieces and implement a Greedy Motif Search Algorithm: #+BEGIN_SRC python def GreedyMotifSearch(Dna, k, t): BestMotifs = [] for i in range(0, t): BestMotifs.append(Dna[i][0:k]) n = len(Dna[0]) for i in range(n-k+1): Motifs = [] Motifs.append(Dna[0][i:i+k]) for j in range(1, t): P = Profile(Motifs[0:j]) Motifs.append(ProfileMostProbableKmer(Dna[j], k, P)) if Score(Motifs) < Score(BestMotifs): BestMotifs = Motifs return BestMotifs def Score(Motifs): score = 0 for i in range(len(Motifs)): score += HammingDistance(Motifs[i], Consensus(Motifs)) return score def Consensus(Motifs): consensus = "" count = Count(Motifs) k = len(Motifs[0]) for j in range(k): m = 0 frequentSymbol = "" for symbol in "ACGT": if count[symbol][j] > m: m = count[symbol][j] frequentSymbol = symbol consensus += frequentSymbol return consensus def Count(Motifs): k = len(Motifs[0]) count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k} t = len(Motifs) for i in range(t): for j in range(k): symbol = Motifs[i][j] count[symbol][j] += 1 return count def HammingDistance(p, q): count = 0 for i in range(0, len(p)): if p[i] != q[i]: count += 1 return count def Profile(Motifs): t = len(Motifs) profile = Count(Motifs) for key, v in profile.items(): v[:] = [x / t for x in v] return profile def ProfileMostProbableKmer(text, k, profile): kmer = "" keys = ["A", "C", "G", "T"] d = dict(zip(keys,profile)) prob = -1 for i in range(len(text)-k+1): if (Pr((text[i:i+k]), profile) > prob): prob = Pr(text[i:i+k], profile) kmer = text[i:i+k] return kmer def Pr(Text, Profile): probability = 1 k = len(Text) for i in range(k): probability *= Profile[Text[i]][i] return probability #+END_SRC ***** Motifs in tuberculosis Tuberculosis is an infectious disease, cause by a bacteria called /Mycobacterium tuberculosis/. The bacteria can stay latent in the host for decades, in hypoxic environments. Our Greedy Algorithm can help us identify a motif that might be involved in the process. The transcription factor behind this behaviour is *DosR*, we'll identify the binding sites: #+BEGIN_SRC python :results output def GreedyMotifSearch(Dna, k, t): BestMotifs = [] for i in range(0, t): BestMotifs.append(Dna[i][0:k]) n = len(Dna[0]) for i in range(n - k + 1): Motifs = [] Motifs.append(Dna[0][i : i + k]) for j in range(1, t): P = Profile(Motifs[0:j]) Motifs.append(ProfileMostProbableKmer(Dna[j], k, P)) if Score(Motifs) < Score(BestMotifs): BestMotifs = Motifs return BestMotifs def Score(Motifs): score = 0 for i in range(len(Motifs)): score += HammingDistance(Motifs[i], Consensus(Motifs)) return score def Consensus(Motifs): consensus = "" count = Count(Motifs) k = len(Motifs[0]) for j in range(k): m = 0 frequentSymbol = "" for symbol in "ACGT": if count[symbol][j] > m: m = count[symbol][j] frequentSymbol = symbol consensus += frequentSymbol return consensus def Count(Motifs): k = len(Motifs[0]) count = {"A": [0] * k, "C": [0] * k, "G": [0] * k, "T": [0] * k} t = len(Motifs) for i in range(t): for j in range(k): symbol = Motifs[i][j] count[symbol][j] += 1 return count def HammingDistance(p, q): count = 0 for i in range(0, len(p)): if p[i] != q[i]: count += 1 return count def Profile(Motifs): t = len(Motifs) profile = Count(Motifs) for key, v in profile.items(): v[:] = [x / t for x in v] return profile def ProfileMostProbableKmer(text, k, profile): kmer = "" keys = ["A", "C", "G", "T"] d = dict(zip(keys, profile)) prob = -1 for i in range(len(text) - k + 1): if Pr((text[i : i + k]), profile) > prob: prob = Pr(text[i : i + k], profile) kmer = text[i : i + k] return kmer def Pr(Text, Profile): probability = 1 k = len(Text) for i in range(k): probability *= Profile[Text[i]][i] return probability Dna = [ "GCGCCCCGCCCGGACAGCCATGCGCTAACCCTGGCTTCGATGGCGCCGGCTCAGTTAGGGCCGGAAGTCCCCAATGTGGCAGACCTTTCGCCCCTGGCGGACGAATGACCCCAGTGGCCGGGACTTCAGGCCCTATCGGAGGGCTCCGGCGCGGTGGTCGGATTTGTCTGTGGAGGTTACACCCCAATCGCAAGGATGCATTATGACCAGCGAGCTGAGCCTGGTCGCCACTGGAAAGGGGAGCAACATC", "CCGATCGGCATCACTATCGGTCCTGCGGCCGCCCATAGCGCTATATCCGGCTGGTGAAATCAATTGACAACCTTCGACTTTGAGGTGGCCTACGGCGAGGACAAGCCAGGCAAGCCAGCTGCCTCAACGCGCGCCAGTACGGGTCCATCGACCCGCGGCCCACGGGTCAAACGACCCTAGTGTTCGCTACGACGTGGTCGTACCTTCGGCAGCAGATCAGCAATAGCACCCCGACTCGAGGAGGATCCCG", "ACCGTCGATGTGCCCGGTCGCGCCGCGTCCACCTCGGTCATCGACCCCACGATGAGGACGCCATCGGCCGCGACCAAGCCCCGTGAAACTCTGACGGCGTGCTGGCCGGGCTGCGGCACCTGATCACCTTAGGGCACTTGGGCCACCACAACGGGCCGCCGGTCTCGACAGTGGCCACCACCACACAGGTGACTTCCGGCGGGACGTAAGTCCCTAACGCGTCGTTCCGCACGCGGTTAGCTTTGCTGCC", "GGGTCAGGTATATTTATCGCACACTTGGGCACATGACACACAAGCGCCAGAATCCCGGACCGAACCGAGCACCGTGGGTGGGCAGCCTCCATACAGCGATGACCTGATCGATCATCGGCCAGGGCGCCGGGCTTCCAACCGTGGCCGTCTCAGTACCCAGCCTCATTGACCCTTCGACGCATCCACTGCGCGTAAGTCGGCTCAACCCTTTCAAACCGCTGGATTACCGACCGCAGAAAGGGGGCAGGAC", "GTAGGTCAAACCGGGTGTACATACCCGCTCAATCGCCCAGCACTTCGGGCAGATCACCGGGTTTCCCCGGTATCACCAATACTGCCACCAAACACAGCAGGCGGGAAGGGGCGAAAGTCCCTTATCCGACAATAAAACTTCGCTTGTTCGACGCCCGGTTCACCCGATATGCACGGCGCCCAGCCATTCGTGACCGACGTCCCCAGCCCCAAGGCCGAACGACCCTAGGAGCCACGAGCAATTCACAGCG", "CCGCTGGCGACGCTGTTCGCCGGCAGCGTGCGTGACGACTTCGAGCTGCCCGACTACACCTGGTGACCACCGCCGACGGGCACCTCTCCGCCAGGTAGGCACGGTTTGTCGCCGGCAATGTGACCTTTGGGCGCGGTCTTGAGGACCTTCGGCCCCACCCACGAGGCCGCCGCCGGCCGATCGTATGACGTGCAATGTACGCCATAGGGTGCGTGTTACGGCGATTACCTGAAGGCGGCGGTGGTCCGGA", "GGCCAACTGCACCGCGCTCTTGATGACATCGGTGGTCACCATGGTGTCCGGCATGATCAACCTCCGCTGTTCGATATCACCCCGATCTTTCTGAACGGCGGTTGGCAGACAACAGGGTCAATGGTCCCCAAGTGGATCACCGACGGGCGCGGACAAATGGCCCGCGCTTCGGGGACTTCTGTCCCTAGCCCTGGCCACGATGGGCTGGTCGGATCAAAGGCATCCGTTTCCATCGATTAGGAGGCATCAA", "GTACATGTCCAGAGCGAGCCTCAGCTTCTGCGCAGCGACGGAAACTGCCACACTCAAAGCCTACTGGGCGCACGTGTGGCAACGAGTCGATCCACACGAAATGCCGCCGTTGGGCCGCGGACTAGCCGAATTTTCCGGGTGGTGACACAGCCCACATTTGGCATGGGACTTTCGGCCCTGTCCGCGTCCGTGTCGGCCAGACAAGCTTTGGGCATTGGCCACAATCGGGCCACAATCGAAAGCCGAGCAG", "GGCAGCTGTCGGCAACTGTAAGCCATTTCTGGGACTTTGCTGTGAAAAGCTGGGCGATGGTTGTGGACCTGGACGAGCCACCCGTGCGATAGGTGAGATTCATTCTCGCCCTGACGGGTTGCGTCTGTCATCGGTCGATAAGGACTAACGGCCCTCAGGTGGGGACCAACGCCCCTGGGAGATAGCGGTCCCCGCCAGTAACGTACCGCTGAACCGACGGGATGTATCCGCCCCAGCGAAGGAGACGGCG", "TCAGCACCATGACCGCCTGGCCACCAATCGCCCGTAACAAGCGGGACGTCCGCGACGACGCGTGCGCTAGCGCCGTGGCGGTGACAACGACCAGATATGGTCCGAGCACGCGGGCGAACCTCGTGTTCTGGCCTCGGCCAGTTGTGTAGAGCTCATCGCTGTCATCGAGCGATATCCGACCACTGATCCAAGTCGGGGGCTCTGGGGACCGAAGTCCCCGGGCTCGGAGCTATCGGACCTCACGATCACC", ] t = len(Dna) k = 15 Motifs = GreedyMotifSearch(Dna, k, t) print(Motifs) print(Score(Motifs)) #+END_SRC #+RESULTS: : ['GTTAGGGCCGGAAGT', 'CCGATCGGCATCACT', 'ACCGTCGATGTGCCC', 'GGGTCAGGTATATTT', 'GTGACCGACGTCCCC', 'CTGTTCGCCGGCAGC', 'CTGTTCGATATCACC', 'GTACATGTCCAGAGC', 'GCGATAGGTGAGATT', 'CTCATCGCTGTCATC'] : 64 Our algorithm is pretty fast, but it's not optimal, and that's just a characteristic of Greedy Algorithms, they trade optimality for speed. ** Vocabulary - k-mer: subsquences of length /k/ in a biological sequence - Frequency map: sequence --> frequency of the sequence