1 Commits

Author SHA1 Message Date
coolneng ca62737884 Generate FASTQ files from the simulated repertoire 2021-04-22 13:36:43 +02:00
14 changed files with 272 additions and 263 deletions
+1
View File
@@ -1 +1,2 @@
*.fasta
*.fastq *.fastq
-68
View File
@@ -1,68 +0,0 @@
# locigenesis
locigenesis is a tool that generates a human T-cell receptor (TCR), runs
it through a sequence reader simulation tool and extracts CDR3.
The goal of this project is to generate both HVR sequences with and
without sequencing errors, in order to create datasets for a Machine
Learning algorithm.
## Technologies
- [immuneSIM](https://github.com/GreiffLab/immuneSIM/): in silico
generation of human and mouse BCR and TCR repertoires
- [CuReSim](http://www.pegase-biosciences.com/curesim-a-customized-read-simulator/):
read simulator that mimics Ion Torrent sequencing
## Installation
This project uses [Nix](https://nixos.org/) to ensure reproducible
builds.
1. Install Nix (compatible with MacOS, Linux and
[WSL](https://docs.microsoft.com/en-us/windows/wsl/about)):
```bash
curl -L https://nixos.org/nix/install | sh
```
2. Clone the repository:
```bash
git clone https://git.coolneng.duckdns.org/coolneng/locigenesis
```
3. Change the working directory to the project:
```bash
cd locigenesis
```
4. Enter the nix-shell:
```bash
nix-shell
```
After running these commands, you will find yourself in a shell that
contains all the needed dependencies.
## Usage
An execution script that accepts 2 parameters is provided, the following
command invokes it:
```bash
./generation.sh <number of sequences> <number of reads>
```
- \<number of sequences\>: an integer that specifies the number of
different sequences to generate
- \<number of reads\>: an integer that specifies the number of reads
to perform on each sequence
The script will generate 2 files under the data directory:
|HVR.fastq | curesim-HVR.fastq |
|:----:|:-----:|
|Contains the original CDR3 sequence|Contains CDR3 after the read simulation, with sequencing errors |
+3
View File
@@ -0,0 +1,3 @@
* locigenesis
locigenesis is a tool that generates an immune repertoire and runs it through a sequence reader simulation tool, to generate sequencing errors.
View File
View File
+46
View File
@@ -0,0 +1,46 @@
#+TITLE: locigenesis
#+AUTHOR: Amin Kasrou Aouam
#+DATE: 2021-03-10
* Sequence alignment
Our generated sequences contain the full VJ region, but we are only interested in the CDR3 (Complementarity-determining region). We will proceed by delimiting CDR3, using the known sequences of V and J.
#+begin_src R :results value silent
v_segments <- readRDS("data/v_segments.rds")
j_segments <- readRDS("data/j_segments_phe.rds")
#+end_src
#+begin_src R
print(v_segments)
print(j_segments)
#+end_src
#+RESULTS:
#+begin_example
A DNAStringSet instance of length 147
width seq names
[1] 326 GATACTGGAATTACCCAGACAC...ATCTCTGCACCAGCAGCCAAGA TRBV1*01_P
[2] 326 GATGCTGAAATCACCCAGAGCC...ATTTCTGCGCCAGCAGTGAGTC TRBV10-1*01_F
[3] 326 GATGCTGAAATCACCCAGAGCC...ATTTCTGCGCCAGCAGTGAGTC TRBV10-1*02_F
[4] 326 GATGCTGGAATCACCCAGAGCC...ATTTCTGCGCCAGCAGTGAGTC TRBV10-2*01_F
[5] 326 GATGCTGGAATCACCCAGAGCC...ATTTCTGCGCCAGCAGTGAGTC TRBV10-2*02_F
... ... ...
[143] 324 GATACTGGAGTCTCCCAGAACC...GTATCTCTGTGCCAGCACGTTG TRBV7-9*06_(F)
[144] 323 .........................TGTATCTCTGTGCCAGCAGCAG TRBV7-9*07_(F)
[145] 325 GATTCTGGAGTCACACAAACCC...TATTTCTGTGCCAGCAGCGTAG TRBV9*01_F
[146] 325 GATTCTGGAGTCACACAAACCC...TATTTCTGTGCCAGCAGCGTAG TRBV9*02_F
[147] 321 GATTCTGGAGTCACACAAACCC...TTTGTATTTCTGTGCCAGCAGC TRBV9*03_(F)
A DNAStringSet instance of length 16
width seq names
[1] 32 TGGGCGTCTGGGCGGAGGACTCCTGGTTCTGG TRBJ2-2P*01_ORF
[2] 31 TTTGGAGAGGGAAGTTGGCTCACTGTTGTAG TRBJ1-3*01_F
[3] 31 TTTGGTGATGGGACTCGACTCTCCATCCTAG TRBJ1-5*01_F
[4] 31 TTTGGCAGTGGAACCCAGCTCTCTGTCTTGG TRBJ1-4*01_F
[5] 31 TTCGGTTCGGGGACCAGGTTAACCGTTGTAG TRBJ1-2*01_F
... ... ...
[12] 31 TTTGGCCCAGGCACCCGGCTGACAGTGCTCG TRBJ2-3*01_F
[13] 31 TTCGGGCCAGGCACGCGGCTCCTGGTGCTCG TRBJ2-5*01_F
[14] 31 TTCGGGCCAGGGACACGGCTCACCGTGCTAG TRBJ2-1*01_F
[15] 31 TTCGGGCCGGGCACCAGGCTCACGGTCACAG TRBJ2-7*01_F
[16] 31 GTCGGGCCGGGCACCAGGCTCACGGTCACAG TRBJ2-7*02_ORF
#+end_example
Generated
-41
View File
@@ -1,41 +0,0 @@
{
"nodes": {
"flake-utils": {
"locked": {
"lastModified": 1634851050,
"narHash": "sha256-N83GlSGPJJdcqhUxSCS/WwW5pksYf3VP1M13cDRTSVA=",
"owner": "numtide",
"repo": "flake-utils",
"rev": "c91f3de5adaf1de973b797ef7485e441a65b8935",
"type": "github"
},
"original": {
"owner": "numtide",
"repo": "flake-utils",
"type": "github"
}
},
"nixpkgs": {
"locked": {
"lastModified": 1635865339,
"narHash": "sha256-fmI8PxMmL7WXV/O8m6vT9/yW42buxvAYeRNpcABvnKs=",
"owner": "NixOS",
"repo": "nixpkgs",
"rev": "26a56abd090ec5c8f4c6c9e1189fbfa4bcb8db3f",
"type": "github"
},
"original": {
"id": "nixpkgs",
"type": "indirect"
}
},
"root": {
"inputs": {
"flake-utils": "flake-utils",
"nixpkgs": "nixpkgs"
}
}
},
"root": "root",
"version": 7
}
-13
View File
@@ -1,13 +0,0 @@
{
description = ''
locigenesis is a tool that generates a human T-cell receptor (TCR), runs
it through a sequence reader simulation tool and extracts CDR3.
'';
inputs.flake-utils.url = "github:numtide/flake-utils";
outputs = { self, nixpkgs, flake-utils }:
flake-utils.lib.eachDefaultSystem (system:
let pkgs = nixpkgs.legacyPackages.${system};
in { devShell = import ./shell.nix { inherit pkgs; }; });
}
+2 -3
View File
@@ -1,7 +1,7 @@
#!/bin/sh #!/bin/sh
usage() { usage() {
echo "usage: generation.sh <number of sequences> <number of reads>" echo "usage: generation.sh <number of sequences> <number_of_reads>"
exit 1 exit 1
} }
@@ -17,6 +17,5 @@ filename="sequence"
prefix="curesim_" prefix="curesim_"
Rscript src/repertoire.r "$sequences" "$number_of_reads" && Rscript src/repertoire.r "$sequences" "$number_of_reads" &&
CuReSim -f "$data_directory$filename$fastq" -o "$data_directory$prefix$filename$fastq" java -jar tools/CuReSim.jar -f "$data_directory$filename$fastq" -o "$data_directory$prefix$filename$fastq"
Rscript src/alignment.r
rm "$data_directory/log.txt" rm "$data_directory/log.txt"
+26
View File
@@ -0,0 +1,26 @@
{
"niv": {
"branch": "master",
"description": "Easy dependency management for Nix projects",
"homepage": "https://github.com/nmattia/niv",
"owner": "nmattia",
"repo": "niv",
"rev": "af958e8057f345ee1aca714c1247ef3ba1c15f5e",
"sha256": "1qjavxabbrsh73yck5dcq8jggvh3r2jkbr6b5nlz5d9yrqm9255n",
"type": "tarball",
"url": "https://github.com/nmattia/niv/archive/af958e8057f345ee1aca714c1247ef3ba1c15f5e.tar.gz",
"url_template": "https://github.com/<owner>/<repo>/archive/<rev>.tar.gz"
},
"nixpkgs": {
"branch": "release-20.09",
"description": "Nix Packages collection",
"homepage": "",
"owner": "NixOS",
"repo": "nixpkgs",
"rev": "6f1ce38d0c0b1b25727d86637fd2f3baf7b0f1f6",
"sha256": "16da722vqn96k1scls8mr8l909hl66r7y4ik6sad4ms3vmxbkbb3",
"type": "tarball",
"url": "https://github.com/NixOS/nixpkgs/archive/6f1ce38d0c0b1b25727d86637fd2f3baf7b0f1f6.tar.gz",
"url_template": "https://github.com/<owner>/<repo>/archive/<rev>.tar.gz"
}
}
+174
View File
@@ -0,0 +1,174 @@
# This file has been generated by Niv.
let
#
# The fetchers. fetch_<type> fetches specs of type <type>.
#
fetch_file = pkgs: name: spec:
let
name' = sanitizeName name + "-src";
in
if spec.builtin or true then
builtins_fetchurl { inherit (spec) url sha256; name = name'; }
else
pkgs.fetchurl { inherit (spec) url sha256; name = name'; };
fetch_tarball = pkgs: name: spec:
let
name' = sanitizeName name + "-src";
in
if spec.builtin or true then
builtins_fetchTarball { name = name'; inherit (spec) url sha256; }
else
pkgs.fetchzip { name = name'; inherit (spec) url sha256; };
fetch_git = name: spec:
let
ref =
if spec ? ref then spec.ref else
if spec ? branch then "refs/heads/${spec.branch}" else
if spec ? tag then "refs/tags/${spec.tag}" else
abort "In git source '${name}': Please specify `ref`, `tag` or `branch`!";
in
builtins.fetchGit { url = spec.repo; inherit (spec) rev; inherit ref; };
fetch_local = spec: spec.path;
fetch_builtin-tarball = name: throw
''[${name}] The niv type "builtin-tarball" is deprecated. You should instead use `builtin = true`.
$ niv modify ${name} -a type=tarball -a builtin=true'';
fetch_builtin-url = name: throw
''[${name}] The niv type "builtin-url" will soon be deprecated. You should instead use `builtin = true`.
$ niv modify ${name} -a type=file -a builtin=true'';
#
# Various helpers
#
# https://github.com/NixOS/nixpkgs/pull/83241/files#diff-c6f540a4f3bfa4b0e8b6bafd4cd54e8bR695
sanitizeName = name:
(
concatMapStrings (s: if builtins.isList s then "-" else s)
(
builtins.split "[^[:alnum:]+._?=-]+"
((x: builtins.elemAt (builtins.match "\\.*(.*)" x) 0) name)
)
);
# The set of packages used when specs are fetched using non-builtins.
mkPkgs = sources: system:
let
sourcesNixpkgs =
import (builtins_fetchTarball { inherit (sources.nixpkgs) url sha256; }) { inherit system; };
hasNixpkgsPath = builtins.any (x: x.prefix == "nixpkgs") builtins.nixPath;
hasThisAsNixpkgsPath = <nixpkgs> == ./.;
in
if builtins.hasAttr "nixpkgs" sources
then sourcesNixpkgs
else if hasNixpkgsPath && ! hasThisAsNixpkgsPath then
import <nixpkgs> {}
else
abort
''
Please specify either <nixpkgs> (through -I or NIX_PATH=nixpkgs=...) or
add a package called "nixpkgs" to your sources.json.
'';
# The actual fetching function.
fetch = pkgs: name: spec:
if ! builtins.hasAttr "type" spec then
abort "ERROR: niv spec ${name} does not have a 'type' attribute"
else if spec.type == "file" then fetch_file pkgs name spec
else if spec.type == "tarball" then fetch_tarball pkgs name spec
else if spec.type == "git" then fetch_git name spec
else if spec.type == "local" then fetch_local spec
else if spec.type == "builtin-tarball" then fetch_builtin-tarball name
else if spec.type == "builtin-url" then fetch_builtin-url name
else
abort "ERROR: niv spec ${name} has unknown type ${builtins.toJSON spec.type}";
# If the environment variable NIV_OVERRIDE_${name} is set, then use
# the path directly as opposed to the fetched source.
replace = name: drv:
let
saneName = stringAsChars (c: if isNull (builtins.match "[a-zA-Z0-9]" c) then "_" else c) name;
ersatz = builtins.getEnv "NIV_OVERRIDE_${saneName}";
in
if ersatz == "" then drv else
# this turns the string into an actual Nix path (for both absolute and
# relative paths)
if builtins.substring 0 1 ersatz == "/" then /. + ersatz else /. + builtins.getEnv "PWD" + "/${ersatz}";
# Ports of functions for older nix versions
# a Nix version of mapAttrs if the built-in doesn't exist
mapAttrs = builtins.mapAttrs or (
f: set: with builtins;
listToAttrs (map (attr: { name = attr; value = f attr set.${attr}; }) (attrNames set))
);
# https://github.com/NixOS/nixpkgs/blob/0258808f5744ca980b9a1f24fe0b1e6f0fecee9c/lib/lists.nix#L295
range = first: last: if first > last then [] else builtins.genList (n: first + n) (last - first + 1);
# https://github.com/NixOS/nixpkgs/blob/0258808f5744ca980b9a1f24fe0b1e6f0fecee9c/lib/strings.nix#L257
stringToCharacters = s: map (p: builtins.substring p 1 s) (range 0 (builtins.stringLength s - 1));
# https://github.com/NixOS/nixpkgs/blob/0258808f5744ca980b9a1f24fe0b1e6f0fecee9c/lib/strings.nix#L269
stringAsChars = f: s: concatStrings (map f (stringToCharacters s));
concatMapStrings = f: list: concatStrings (map f list);
concatStrings = builtins.concatStringsSep "";
# https://github.com/NixOS/nixpkgs/blob/8a9f58a375c401b96da862d969f66429def1d118/lib/attrsets.nix#L331
optionalAttrs = cond: as: if cond then as else {};
# fetchTarball version that is compatible between all the versions of Nix
builtins_fetchTarball = { url, name ? null, sha256 }@attrs:
let
inherit (builtins) lessThan nixVersion fetchTarball;
in
if lessThan nixVersion "1.12" then
fetchTarball ({ inherit url; } // (optionalAttrs (!isNull name) { inherit name; }))
else
fetchTarball attrs;
# fetchurl version that is compatible between all the versions of Nix
builtins_fetchurl = { url, name ? null, sha256 }@attrs:
let
inherit (builtins) lessThan nixVersion fetchurl;
in
if lessThan nixVersion "1.12" then
fetchurl ({ inherit url; } // (optionalAttrs (!isNull name) { inherit name; }))
else
fetchurl attrs;
# Create the final "sources" from the config
mkSources = config:
mapAttrs (
name: spec:
if builtins.hasAttr "outPath" spec
then abort
"The values in sources.json should not have an 'outPath' attribute"
else
spec // { outPath = replace name (fetch config.pkgs name spec); }
) config.sources;
# The "config" used by the fetchers
mkConfig =
{ sourcesFile ? if builtins.pathExists ./sources.json then ./sources.json else null
, sources ? if isNull sourcesFile then {} else builtins.fromJSON (builtins.readFile sourcesFile)
, system ? builtins.currentSystem
, pkgs ? mkPkgs sources system
}: rec {
# The sources, i.e. the attribute set of spec name to spec
inherit sources;
# The "pkgs" (evaluated nixpkgs) to use for e.g. non-builtin fetchers
inherit pkgs;
};
in
mkSources (mkConfig {}) // { __functor = _: settings: mkSources (mkConfig settings); }
+11 -25
View File
@@ -1,29 +1,15 @@
{ pkgs ? import <nixpkgs> { } }: { sources ? import ./nix/sources.nix, pkgs ? import sources.nixpkgs { } }:
with pkgs; with pkgs;
let mkShell {
CuReSim = stdenv.mkDerivation rec { buildInputs = [
name = "CuReSim"; R
version = "1.3"; rPackages.immuneSIM
src = fetchzip { url = rPackages.Biostrings
"http://www.pegase-biosciences.com/wp-content/uploads/2015/08/${name}${version}.zip"; jdk
sha256 = "1hvlpgy4haqgqq52mkxhcl9i1fx67kgwi6f1mijvqzk0xff77hkp"; # Development tools
stripRoot = true; rPackages.languageserver
extraPostFetch = '' rPackages.lintr
chmod go-w $out ];
'';
};
nativeBuildInputs = [ makeWrapper ];
installPhase = ''
mkdir -pv $out/share/java $out/bin
cp -r ${src} $out/share/java/${name}
makeWrapper ${jre}/bin/java $out/bin/CuReSim --add-flags "-jar $out/share/java/${name}/${name}.jar"
'';
};
in mkShell {
buildInputs =
[ R rPackages.immuneSIM rPackages.Biostrings rPackages.stringr CuReSim ];
} }
+9 -98
View File
@@ -1,10 +1,6 @@
library(Biostrings) library(Biostrings)
library(parallel) library(parallel)
#' Import and process the TCR and VJ sequences
#'
#' @param file A file path with the sequences after applying a read simulator
#' @return A \code{list} with the TCR sequences and VJ sequences
parse_data <- function(file) { parse_data <- function(file) {
reversed_sequences <- Biostrings::readQualityScaledDNAStringSet(file) reversed_sequences <- Biostrings::readQualityScaledDNAStringSet(file)
sequences <- Biostrings::reverseComplement(reversed_sequences) sequences <- Biostrings::reverseComplement(reversed_sequences)
@@ -15,10 +11,6 @@ parse_data <- function(file) {
return(list(sequences, vj_segments)) return(list(sequences, vj_segments))
} }
#' Extracts the VJ metadata from the sequences read identifier
#'
#' @param metadata The read identifier of a sequence
#' @return A \code{list} with the V and J gene identifier
parse_metadata <- function(metadata) { parse_metadata <- function(metadata) {
id_elements <- unlist(strsplit(metadata, split = " ")) id_elements <- unlist(strsplit(metadata, split = " "))
v_identifier <- id_elements[2] v_identifier <- id_elements[2]
@@ -26,28 +18,12 @@ parse_metadata <- function(metadata) {
return(list(v_id = v_identifier, j_id = j_identifier)) return(list(v_id = v_identifier, j_id = j_identifier))
} }
#' Fetches the sequence that matches the VJ gene identifier
#'
#' @param names The names of the VJ sequences
#' @param vdj_segments A \code{DNAStringSet} containing the VJ sequences
#' @param id The read identifier of a sequence
#' @return A \code{character} containing the gene sequence
match_id_sequence <- function(names, vdj_segments, id) { match_id_sequence <- function(names, vdj_segments, id) {
matches <- grep(names, pattern = id) matches <- grep(names, pattern = id)
if(id == "TRBJ2-2"){ row <- matches[1]
row <- matches[2]
} else {
row <- matches[1]
}
return(as.character(vdj_segments[row])) return(as.character(vdj_segments[row]))
} }
#' Gets the V and J sequences for a particular read identifier
#'
#' @param metadata The read identifier of a sequence
#' @param names The names of the VJ sequences
#' @param vdj_segments A \code{DNAStringSet} containing the VJ sequences
#' @return A \code{list} with the V and J sequences
get_vj_sequence <- function(metadata, names, vdj_segments) { get_vj_sequence <- function(metadata, names, vdj_segments) {
identifiers <- parse_metadata(metadata) identifiers <- parse_metadata(metadata)
v_sequence <- match_id_sequence(names, vdj_segments, id = identifiers["v_id"]) v_sequence <- match_id_sequence(names, vdj_segments, id = identifiers["v_id"])
@@ -55,11 +31,6 @@ get_vj_sequence <- function(metadata, names, vdj_segments) {
return(list(v_seq = v_sequence, j_seq = j_sequence)) return(list(v_seq = v_sequence, j_seq = j_sequence))
} }
#' Obtains the VJ sequences for all the TCR sequences
#'
#' @param sequences A \code{QualityScaledDNAStringSet} with the TCR sequences
#' @param vdj_segments A \code{DNAStringSet} containing the VJ sequences
#' @return A \code{data.frame} with the V and J sequences
fetch_vj_sequences <- function(sequences, vdj_segments) { fetch_vj_sequences <- function(sequences, vdj_segments) {
vj_sequences <- sapply(names(sequences), vj_sequences <- sapply(names(sequences),
names(vdj_segments), names(vdj_segments),
@@ -70,11 +41,6 @@ fetch_vj_sequences <- function(sequences, vdj_segments) {
return(results) return(results)
} }
#' Perform a pairwise alignment of a sequence with the canonical V or J sequence
#'
#' @param sequence A \code{DNAString} containing the TCR sequences
#' @param vdj_segment A \code{DNAString} containing the V or J sequence
#' @return A \code{PairwiseAlignments}
align_sequence <- function(sequence, vdj_segment) { align_sequence <- function(sequence, vdj_segment) {
return(Biostrings::pairwiseAlignment( return(Biostrings::pairwiseAlignment(
subject = sequence, subject = sequence,
@@ -84,70 +50,15 @@ align_sequence <- function(sequence, vdj_segment) {
)) ))
} }
#' Computes the coordinate shift of the Cysteine due to indels # TODO Extract CDR3
#' get_hvr_sequences <- function(sequences, vdj_segments) {
#' @param insertion An \code{IRanges} containing the insertions
#' @param deletion An \code{IRanges} containing the deletions
#' @param cys A \code{list} with the Cysteine coordinates
#' @param alignment A \code{PairwiseAlignments}
#' @return A \code{list} with the delta of the Cysteine coordinates
handle_indels <- function(insertion, deletion, cys, alignment) {
ins_start <- sum(Biostrings::width(deletion[start(deletion) <= cys$start]))
ins_end <- sum(Biostrings::width(deletion[end(deletion) <= cys$end]))
shift_num <- c(0, cumsum(Biostrings::width(insertion))[-length(ins_start)])
shifted_ins <- IRanges::shift(insertion, shift_num)
gaps <- sum(width(shifted_ins[end(shifted_ins) < cys$start + ins_start])) +
nchar(stringr::str_extract(alignedSubject(alignment), "^-*"))
return(list("start" = ins_start - gaps, "end" = ins_end - gaps))
}
#' Find the coordinates of the first Cysteine of the HVR
#'
#' @param alignment A \code{PairwiseAlignments}
#' @return A \code{list} with the Cysteine coordinates
get_cys_coordinates <- function(alignment) {
cys <- list("start" = 310, "end" = 312)
insertion <- unlist(Biostrings::insertion(alignment))
deletion <- unlist(Biostrings::deletion(alignment))
delta_coordinates <- handle_indels(insertion, deletion, cys, alignment)
read_start <- unlist(start(Biostrings::Views(alignment)))
cys_start <- cys$start + delta_coordinates$start + read_start - 1
cys_end <- cys$end + delta_coordinates$end + read_start
return(list("start" = cys_start, "end" = cys_end))
}
#' Delimit the hypervariable region (HVR) for each TCR sequence
#'
#' @param sequences A \code{QualityScaledDNAStringSet} with the TCR sequences
#' @param vdj_segments A \code{DNAStringSet} containing the VJ sequences
#' @param cores Number of cores to apply multiprocessing
#' @return A \code{QualityScaledDNAStringSet} containing the HVR
get_hvr_sequences <- function(sequences, vdj_segments, cores = detectCores()) {
df <- fetch_vj_sequences(sequences, vdj_segments) df <- fetch_vj_sequences(sequences, vdj_segments)
v_alignment <- parallel::mcmapply(sequences, v_alignment <- parallel::mcmapply(sequences, df$v_seq, FUN = align_sequence)
df$v_seq, j_alignment <- parallel::mcmapply(sequences, df$j_seq, FUN = align_sequence)
FUN = align_sequence,
mc.cores = cores
)
cys_coordinates <- parallel::mclapply(v_alignment, FUN = get_cys_coordinates)
cys_df <- as.data.frame(do.call(rbind, cys_coordinates))
remaining <- Biostrings::subseq(sequences, start = unlist(cys_df$end) + 1)
j_alignment <- parallel::mcmapply(remaining,
df$j_seq,
FUN = align_sequence,
mc.cores = cores
)
j_start <- parallel::mclapply(
j_alignment,
function(x) start(Biostrings::Views(x)),
mc.cores = cores
)
hvr_start <- unlist(cys_df$start)
hvr_end <- unlist(cys_df$start) + unlist(j_start) + 2
hvr <- Biostrings::subseq(sequences, start = hvr_start, end = hvr_end)
return(hvr)
} }
data <- parse_data(file = "data/curesim_sequence.fastq") data <- parse_data(file = "data/curesim_sequence.fastq")
hvr <- get_hvr_sequences(sequences = data[[1]], vdj_segments = data[[2]]) hvr_sequences <- get_hvr_sequences(
Biostrings::writeXStringSet(hvr, "data/curesim-HVR.fastq", format = "fastq") sequences = data[[1]],
vdj_segments = data[[2]]
)
-15
View File
@@ -1,10 +1,6 @@
library(immuneSIM) library(immuneSIM)
library(Biostrings) library(Biostrings)
#' Generate the beta chain of a human T-cell receptor (TCR)
#'
#' @param number_of_sequences Number of different sequences to generate
#' @return A \code{data.frame} with the sequences, V and J genes and CDR3
generate_repertoire <- function(number_of_sequences) { generate_repertoire <- function(number_of_sequences) {
return(immuneSIM( return(immuneSIM(
number_of_seqs = number_of_sequences, number_of_seqs = number_of_sequences,
@@ -14,9 +10,6 @@ generate_repertoire <- function(number_of_sequences) {
)) ))
} }
#' Saves the sequences and CDR3 to FASTQ files
#'
#' @param data A \code{data.frame} with the preprocessed TCR sequences and CDR3
save_data <- function(data) { save_data <- function(data) {
Biostrings::writeXStringSet(data$sequence, Biostrings::writeXStringSet(data$sequence,
"data/sequence.fastq", "data/sequence.fastq",
@@ -25,11 +18,6 @@ save_data <- function(data) {
Biostrings::writeXStringSet(data$junction, "data/HVR.fastq", format = "fastq") Biostrings::writeXStringSet(data$junction, "data/HVR.fastq", format = "fastq")
} }
#' Applies the reverse complement and amplifies the number of sequences
#'
#' @param data A \code{data.frame} containing the TCR sequences and CDR3
#' @param reads Number of times to amplify each sequence
#' @return A \code{data.frame} with reverse complement sequences and VJ metadata
process_data <- function(data, reads) { process_data <- function(data, reads) {
dna_sequence <- Biostrings::DNAStringSet(data$sequence) dna_sequence <- Biostrings::DNAStringSet(data$sequence)
data$sequence <- Biostrings::reverseComplement(dna_sequence) data$sequence <- Biostrings::reverseComplement(dna_sequence)
@@ -40,9 +28,6 @@ process_data <- function(data, reads) {
return(amplified_data) return(amplified_data)
} }
#' Checks the number of command line arguments and captures them
#'
#' @return A \code{vector} containing the command line arguments
parse_cli_arguments <- function() { parse_cli_arguments <- function() {
args <- commandArgs(trailingOnly = TRUE) args <- commandArgs(trailingOnly = TRUE)
if (length(args) != 2) { if (length(args) != 2) {