Files
bioinformatics-course/Notebook.org
T

693 lines
21 KiB
Org Mode

* Biology Meets Programming: Bioinformatics for Beginners
** Week 1
*** DNA replication
**** Origin of replication (ori)
Locating an ori is key for gene therapy (e.g. viral vectors), to introduce a theraupetic gene.
**** Computational approaches to find ori in Vibrio Cholerae
***** Exercise: find Pattern
We'll look for the *DnaA box* sequence, using a sliding window, in that case we will use this function to find out how many times
does a sequence appear in the genome:
#+BEGIN_SRC python
def PatternCount(Text, Pattern):
count = 0
for i in range(len(Text)-len(Pattern)+1):
if Text[i:i+len(Pattern)] == Pattern:
count = count+1
return count
#+END_SRC
For the second part, we're going to calculate the frequency map of the sequences
of length /k/, for that purpose we'll use:
#+BEGIN_SRC python
def FrequentWords(Text, k):
words = []
freq = FrequencyMap(Text, k)
m = max(freq.values())
for key in freq:
if freq[key] == m:
words.append(key)
return words
def FrequencyMap(Text, k):
freq = {}
n = len(Text)
for i in range(n - k + 1):
Pattern = Text[i:i + k]
freq[Pattern] = 0
for i in range(n - k + 1):
Pattern = Text[i:i + k]
freq[Pattern] += 1
return freq
#+END_SRC
***** Exercise: Find the reverse complement of a sequence
We're going to generate the reverse complement of a sequence, which is the complement of a sequence, read in the same direction (5' -> 3').
In this case, we're going to use:
#+BEGIN_SRC python
def ReverseComplement(Pattern):
Pattern = Reverse(Pattern)
Pattern = Complement(Pattern)
return Pattern
def Reverse(Pattern):
reversed = Pattern[::-1]
return reversed
def Complement(Pattern):
compl = ""
complement_letters = {"A": "T", "T": "A", "C": "G", "G": "C"}
for char in Pattern:
compl += complement_letters[char]
return compl
#+END_SRC
After using our function on the /Vibrio Cholerae's/ genome, we realize that some of the frequent /k-mers/ are reverse complements of other frequent ones.
***** Exercise: Find a subsequence within a sequence
We're going to find the ocurrences of a subsquence inside a sequence, and save the index of the first letter in the sequence.
This time, we'll use:
#+BEGIN_SRC python
def PatternMatching(Pattern, Genome):
positions = []
for i in range(len(Genome)-len(Pattern)+1):
if Genome[i:i+len(Pattern)] == Pattern:
positions.append(i)
return positions
#+END_SRC
After using our function on the /Vibrio Cholerae's/ genome, we find out that the /9-mers/ with the highest frequency appear in cluster.
This is strong statistical evidence that our subsequences are /DnaA boxes/.
**** Computational approaches to find ori in any bacteria
Now that we're pretty confident about the /DnaA boxes/ sequences that we found, we are going to check if they are a common pattern in the rest of bacterias.
We're going to find the ocurrences of the sequences in /Thermotoga petrophila/
with:
#+BEGIN_SRC python
def PatternCount(Text, Pattern):
count = 0
for i in range(len(Text)-len(Pattern)+1):
if Text[i:i+len(Pattern)] == Pattern:
count = count+1
return count
#+END_SRC
After the execution, we observe that there are *no* ocurrences of the sequences found in /Vibrio Cholerae/.
We can conclude that different bacterias have different /DnaA boxes/.
We have to try another computational approach then, find clusters of /k-mers/ repeated in a small interval.
** Week 2
*** DNA replication (II)
**** Replication process
The /DNA polymerases/ start replicating while the parent strands are unraveling.
On the lagging strand, the DNA polymerase waits until the replication fork opens around 2000 nucleotides, and because of that it forms Okazaki fragments.
We need 1 primer for the leading strand and 1 primer per Okazaki fragment for the lagging strand.
While the Okazaki fragments are being synthetized, a /DNA ligase/ starts joining the fragments together.
**** Computational approach to find ori using deamination
As the lagging strand is always waiting for the helicase to go forward, the lagging strand is mostly in single-stranded configuration, which is more prone to mutations.
One frequent form of mutation is *deamination*, a process that causes cytosine to convert into thymine. This means that cytosine is more frequent in half of the genome.
***** Exercise: count the ocurrences of cytosine
We're going to count the ocurrences of the bases in a genome and include them in
a symbol array, for that purpose we'll use:
#+BEGIN_SRC python
def SymbolArray(Genome, symbol):
array = {}
n = len(Genome)
ExtendedGenome = Genome + Genome[0:n//2]
for i in range(n):
array[i] = PatternCount(ExtendedGenome[i:i+(n//2)], symbol)
return array
def PatternCount(Text, Pattern):
count = 0
for i in range(len(Text)-len(Pattern)+1):
if Text[i:i+len(Pattern)] == Pattern:
count = count+1
return count
#+END_SRC
After executing the program, we realize that the algorithm is too inefficient.
***** Exercise: find a better algorithm for the previous exercise
This time, we are going to evaluate an element /i+1/, using the element /i/.
We'll use the following algorithm:
#+BEGIN_SRC python
def FasterSymbolArray(Genome, symbol):
array = {}
n = len(Genome)
ExtendedGenome = Genome + Genome[0:n//2]
array[0] = PatternCount(symbol, Genome[0:n//2])
for i in range(1, n):
array[i] = array[i-1]
if ExtendedGenome[i-1] == symbol:
array[i] = array[i]-1
if ExtendedGenome[i+(n//2)-1] == symbol:
array[i] = array[i]+1
return array
def PatternCount(Text, Pattern):
count = 0
for i in range(len(Text)-len(Pattern)+1):
if Text[i:i+len(Pattern)] == Pattern:
count = count+1
return count
#+END_SRC
After executing the program we see that it's a viable algorithm, with a complexity of /O(n)/ instead of the previous /O(n²)/.
In /Escherichia Coli/ we plotted the result of our program:
#+CAPTION: Symbol array for Cytosine in E. Coli Genome]
[[./Assets/e-coli.png]]
From that graph, we conclude that ori is located around position 4000000, because that's where the Cytosine concentration is the lowest,
which indicates that the region stays single-stranded for the longest time.
**** The Skew Diagram
Usually scientists measure the difference between /G - C/, which is *higher on the lagging strand* and *lower on the leading strand*.
***** Exercise: Synthetize a Skew Array
We're going to make a Skew Diagram, for that we'll first need a Skew Array. For
that purpose we wrote:
#+BEGIN_SRC python
def SkewArray(Genome):
Skew = []
Skew.append(0)
for i in range(0, len(Genome)):
if Genome[i] == "G":
Skew.append(Skew[i] + 1)
elif Genome[i] == "C":
Skew.append(Skew[i] - 1)
else:
Skew.append(Skew[i])
return Skew
#+END_SRC
We can see the utility of a Skew Diagram looking at the one from /Escherichia Coli/:
#+CAPTION: Symbol array for Cytosine in E. Coli Genome]
[[./Assets/skew_diagram.png]]
Ori should be located where the skew is at its minimum value.
***** Exercise: Efficient algorithm for locating ori
Now that we know more about ori's skew value, we're going to construct a better
algorithm to find it:
#+BEGIN_SRC python
def MinimumSkew(Genome):
positions = []
skew = SkewArray(Genome)
minimum = min(skew)
return [i for i in range(0, len(Genome)) if skew[i] == minimum]
def SkewArray(Genome):
Skew = []
Skew.append(0)
for i in range(0, len(Genome)):
if Genome[i] == "G":
Skew.append(Skew[i] + 1)
elif Genome[i] == "C":
Skew.append(Skew[i] - 1)
else:
Skew.append(Skew[i])
return Skew
#+END_SRC
**** Finding /DnaA boxes/
When we look for /DnaA boxes/ in the minimal skew region, we can't find highly repeated /9-mers/ in /Escherichia Coli/.
But we find approximate sequences that are similar to our /9-mers/ and only differ in 1 nucleotide.
***** Exercise: Calculate Hamming distance
The Hamming distance is the number of mismatches between 2 strings, we'll solve this problem in [[./Code/HammingDistance][HammingDistance]]
***** Exercise: Find approximate patterns
Now that we have our Hamming distance, we have to find the approximate
sequences:
#+BEGIN_SRC python
def ApproximatePatternMatching(Text, Pattern, d):
positions = []
for i in range(len(Text)-len(Pattern)+1):
if Text[i:i+len(Pattern)] == Pattern:
positions.append(i)
elif HammingDistance(Text[i:i+len(Pattern)], Pattern) <= d:
positions.append(i)
return positions
def HammingDistance(p, q):
count = 0
for i in range(0, len(p)):
if p[i] != q[i]:
count += 1
return count
#+END_SRC
***** Exercise: Count the approximate patterns
The final part is counting the approximate sequences:
#+BEGIN_SRC python
def ApproximatePatternCount(Pattern, Text, d):
count = 0
for i in range(len(Text)-len(Pattern)+1):
if Text[i:i+len(Pattern)] == Pattern or HammingDistance(Text[i:i+len(Pattern)], Pattern) <= d:
count += 1
return count
def HammingDistance(p, q):
count = 0
for i in range(0, len(p)):
if p[i] != q[i]:
count += 1
return count
#+END_SRC
After trying out our ApproximatePatternCount in the hypothesized ori region, we find a frequent /k-mer/ with its reverse complement in /Escherichia Coli/.
We've finally found a computational method to find ori that seems correct.
** Week 3
*** The circadian clock
Variation in gene expression permits the cell to keep track of time.
**** Computational approaches to find regulatory motifs
***** Exercise: Find the most common nucleotides in each position
We are going to create a *t x k* Motif Matrix, where *t* is the /k-mer/ string. In each position, we'll insert the most frequent nucleotide, in upper case,
and the nucleotide in lower case (if there's no popular one).
Our goal is to select the *most* conserved Matrix, i.e. the Matrix with the most upper case letters.
We'll use a *4 x k* Count Matrix, one row for each base. We'll first generate
the Matrix:
#+BEGIN_SRC python
def Count(Motifs):
k = len(Motifs[0])
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
t = len(Motifs)
for i in range(t):
for j in range(k):
symbol = Motifs[i][j]
count[symbol][j] += 1
return count
#+END_SRC
Now that we have a Count Matrix, we will generate a Profile Matrix, which has
the frequency of the nucleotide instead of the count:
#+BEGIN_SRC python
def Profile(Motifs):
t = len(Motifs)
profile = Count(Motifs)
for key, v in profile.items():
v[:] = [x / t for x in v]
return profile
def Count(Motifs):
k = len(Motifs[0])
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
t = len(Motifs)
for i in range(t):
for j in range(k):
symbol = Motifs[i][j]
count[symbol][j] += 1
return count
#+END_SRC
***** Exercise: Form the most frequent sequence of nucleotides
Finally, we can form a Consensus string, to get a candidate regulatory motif:
#+BEGIN_SRC python
def Consensus(Motifs):
consensus = ""
count = Count(Motifs)
k = len(Motifs[0])
for j in range(k):
m = 0
frequentSymbol = ""
for symbol in "ACGT":
if count[symbol][j] > m:
m = count[symbol][j]
frequentSymbol = symbol
consensus += frequentSymbol
return consensus
def Count(Motifs):
k = len(Motifs[0])
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
t = len(Motifs)
for i in range(t):
for j in range(k):
symbol = Motifs[i][j]
count[symbol][j] += 1
return count
#+END_SRC
After obtaining the Consensus string, all we need to do is obtains the total
score of our selected /k-mers/:
#+BEGIN_SRC python
def Score(Motifs):
score = 0
for i in range(len(Motifs)):
score += HammingDistance(Motifs[i], Consensus(Motifs))
return score
def Consensus(Motifs):
consensus = ""
count = Count(Motifs)
k = len(Motifs[0])
for j in range(k):
m = 0
frequentSymbol = ""
for symbol in "ACGT":
if count[symbol][j] > m:
m = count[symbol][j]
frequentSymbol = symbol
consensus += frequentSymbol
return consensus
def Count(Motifs):
k = len(Motifs[0])
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
t = len(Motifs)
for i in range(t):
for j in range(k):
symbol = Motifs[i][j]
count[symbol][j] += 1
return count
def HammingDistance(p, q):
count = 0
for i in range(0, len(p)):
if p[i] != q[i]:
count += 1
return count
#+END_SRC
***** Exercise: Find a set of /k-mers/ that minimize the score
Applying a brute force approach for this task is not viable, we'll use a Greedy Algorithm. For that, we'll first determine the probability
of a sequence, we'll use:
#+BEGIN_SRC python
def Pr(Text, Profile):
probability = 1
k = len(Text)
for i in range(k):
probability *= Profile[Text[i]][i]
return probability
#+END_SRC
We'll use this function to find the most probable /k-mer/ in a sequence:
#+BEGIN_SRC python
def ProfileMostProbableKmer(text, k, profile):
kmer = ""
keys = ["A", "C", "G", "T"]
d = dict(zip(keys,profile))
prob = -1
for i in range(len(text)-k+1):
if (Pr((text[i:i+k]), profile) > prob):
prob = Pr(text[i:i+k], profile)
kmer = text[i:i+k]
return kmer
def Pr(Text, Profile):
probability = 1
k = len(Text)
for i in range(k):
probability *= Profile[Text[i]][i]
return probability
#+END_SRC
Now we're finally ready to assemble all the pieces and implement a Greedy Motif
Search Algorithm:
#+BEGIN_SRC python
def GreedyMotifSearch(Dna, k, t):
BestMotifs = []
for i in range(0, t):
BestMotifs.append(Dna[i][0:k])
n = len(Dna[0])
for i in range(n-k+1):
Motifs = []
Motifs.append(Dna[0][i:i+k])
for j in range(1, t):
P = Profile(Motifs[0:j])
Motifs.append(ProfileMostProbableKmer(Dna[j], k, P))
if Score(Motifs) < Score(BestMotifs):
BestMotifs = Motifs
return BestMotifs
def Score(Motifs):
score = 0
for i in range(len(Motifs)):
score += HammingDistance(Motifs[i], Consensus(Motifs))
return score
def Consensus(Motifs):
consensus = ""
count = Count(Motifs)
k = len(Motifs[0])
for j in range(k):
m = 0
frequentSymbol = ""
for symbol in "ACGT":
if count[symbol][j] > m:
m = count[symbol][j]
frequentSymbol = symbol
consensus += frequentSymbol
return consensus
def Count(Motifs):
k = len(Motifs[0])
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
t = len(Motifs)
for i in range(t):
for j in range(k):
symbol = Motifs[i][j]
count[symbol][j] += 1
return count
def HammingDistance(p, q):
count = 0
for i in range(0, len(p)):
if p[i] != q[i]:
count += 1
return count
def Profile(Motifs):
t = len(Motifs)
profile = Count(Motifs)
for key, v in profile.items():
v[:] = [x / t for x in v]
return profile
def ProfileMostProbableKmer(text, k, profile):
kmer = ""
keys = ["A", "C", "G", "T"]
d = dict(zip(keys,profile))
prob = -1
for i in range(len(text)-k+1):
if (Pr((text[i:i+k]), profile) > prob):
prob = Pr(text[i:i+k], profile)
kmer = text[i:i+k]
return kmer
def Pr(Text, Profile):
probability = 1
k = len(Text)
for i in range(k):
probability *= Profile[Text[i]][i]
return probability
#+END_SRC
***** Motifs in tuberculosis
Tuberculosis is an infectious disease, cause by a bacteria called /Mycobacterium
tuberculosis/. The bacteria can stay latent in the host for decades, in hypoxic
environments.
Our Greedy Algorithm can help us identify a motif that might be involved in the process.
The transcription factor behind this behaviour is *DosR*, we'll identify the
binding sites:
#+BEGIN_SRC python :results output
def GreedyMotifSearch(Dna, k, t):
BestMotifs = []
for i in range(0, t):
BestMotifs.append(Dna[i][0:k])
n = len(Dna[0])
for i in range(n - k + 1):
Motifs = []
Motifs.append(Dna[0][i : i + k])
for j in range(1, t):
P = Profile(Motifs[0:j])
Motifs.append(ProfileMostProbableKmer(Dna[j], k, P))
if Score(Motifs) < Score(BestMotifs):
BestMotifs = Motifs
return BestMotifs
def Score(Motifs):
score = 0
for i in range(len(Motifs)):
score += HammingDistance(Motifs[i], Consensus(Motifs))
return score
def Consensus(Motifs):
consensus = ""
count = Count(Motifs)
k = len(Motifs[0])
for j in range(k):
m = 0
frequentSymbol = ""
for symbol in "ACGT":
if count[symbol][j] > m:
m = count[symbol][j]
frequentSymbol = symbol
consensus += frequentSymbol
return consensus
def Count(Motifs):
k = len(Motifs[0])
count = {"A": [0] * k, "C": [0] * k, "G": [0] * k, "T": [0] * k}
t = len(Motifs)
for i in range(t):
for j in range(k):
symbol = Motifs[i][j]
count[symbol][j] += 1
return count
def HammingDistance(p, q):
count = 0
for i in range(0, len(p)):
if p[i] != q[i]:
count += 1
return count
def Profile(Motifs):
t = len(Motifs)
profile = Count(Motifs)
for key, v in profile.items():
v[:] = [x / t for x in v]
return profile
def ProfileMostProbableKmer(text, k, profile):
kmer = ""
keys = ["A", "C", "G", "T"]
d = dict(zip(keys, profile))
prob = -1
for i in range(len(text) - k + 1):
if Pr((text[i : i + k]), profile) > prob:
prob = Pr(text[i : i + k], profile)
kmer = text[i : i + k]
return kmer
def Pr(Text, Profile):
probability = 1
k = len(Text)
for i in range(k):
probability *= Profile[Text[i]][i]
return probability
Dna = [
"GCGCCCCGCCCGGACAGCCATGCGCTAACCCTGGCTTCGATGGCGCCGGCTCAGTTAGGGCCGGAAGTCCCCAATGTGGCAGACCTTTCGCCCCTGGCGGACGAATGACCCCAGTGGCCGGGACTTCAGGCCCTATCGGAGGGCTCCGGCGCGGTGGTCGGATTTGTCTGTGGAGGTTACACCCCAATCGCAAGGATGCATTATGACCAGCGAGCTGAGCCTGGTCGCCACTGGAAAGGGGAGCAACATC",
"CCGATCGGCATCACTATCGGTCCTGCGGCCGCCCATAGCGCTATATCCGGCTGGTGAAATCAATTGACAACCTTCGACTTTGAGGTGGCCTACGGCGAGGACAAGCCAGGCAAGCCAGCTGCCTCAACGCGCGCCAGTACGGGTCCATCGACCCGCGGCCCACGGGTCAAACGACCCTAGTGTTCGCTACGACGTGGTCGTACCTTCGGCAGCAGATCAGCAATAGCACCCCGACTCGAGGAGGATCCCG",
"ACCGTCGATGTGCCCGGTCGCGCCGCGTCCACCTCGGTCATCGACCCCACGATGAGGACGCCATCGGCCGCGACCAAGCCCCGTGAAACTCTGACGGCGTGCTGGCCGGGCTGCGGCACCTGATCACCTTAGGGCACTTGGGCCACCACAACGGGCCGCCGGTCTCGACAGTGGCCACCACCACACAGGTGACTTCCGGCGGGACGTAAGTCCCTAACGCGTCGTTCCGCACGCGGTTAGCTTTGCTGCC",
"GGGTCAGGTATATTTATCGCACACTTGGGCACATGACACACAAGCGCCAGAATCCCGGACCGAACCGAGCACCGTGGGTGGGCAGCCTCCATACAGCGATGACCTGATCGATCATCGGCCAGGGCGCCGGGCTTCCAACCGTGGCCGTCTCAGTACCCAGCCTCATTGACCCTTCGACGCATCCACTGCGCGTAAGTCGGCTCAACCCTTTCAAACCGCTGGATTACCGACCGCAGAAAGGGGGCAGGAC",
"GTAGGTCAAACCGGGTGTACATACCCGCTCAATCGCCCAGCACTTCGGGCAGATCACCGGGTTTCCCCGGTATCACCAATACTGCCACCAAACACAGCAGGCGGGAAGGGGCGAAAGTCCCTTATCCGACAATAAAACTTCGCTTGTTCGACGCCCGGTTCACCCGATATGCACGGCGCCCAGCCATTCGTGACCGACGTCCCCAGCCCCAAGGCCGAACGACCCTAGGAGCCACGAGCAATTCACAGCG",
"CCGCTGGCGACGCTGTTCGCCGGCAGCGTGCGTGACGACTTCGAGCTGCCCGACTACACCTGGTGACCACCGCCGACGGGCACCTCTCCGCCAGGTAGGCACGGTTTGTCGCCGGCAATGTGACCTTTGGGCGCGGTCTTGAGGACCTTCGGCCCCACCCACGAGGCCGCCGCCGGCCGATCGTATGACGTGCAATGTACGCCATAGGGTGCGTGTTACGGCGATTACCTGAAGGCGGCGGTGGTCCGGA",
"GGCCAACTGCACCGCGCTCTTGATGACATCGGTGGTCACCATGGTGTCCGGCATGATCAACCTCCGCTGTTCGATATCACCCCGATCTTTCTGAACGGCGGTTGGCAGACAACAGGGTCAATGGTCCCCAAGTGGATCACCGACGGGCGCGGACAAATGGCCCGCGCTTCGGGGACTTCTGTCCCTAGCCCTGGCCACGATGGGCTGGTCGGATCAAAGGCATCCGTTTCCATCGATTAGGAGGCATCAA",
"GTACATGTCCAGAGCGAGCCTCAGCTTCTGCGCAGCGACGGAAACTGCCACACTCAAAGCCTACTGGGCGCACGTGTGGCAACGAGTCGATCCACACGAAATGCCGCCGTTGGGCCGCGGACTAGCCGAATTTTCCGGGTGGTGACACAGCCCACATTTGGCATGGGACTTTCGGCCCTGTCCGCGTCCGTGTCGGCCAGACAAGCTTTGGGCATTGGCCACAATCGGGCCACAATCGAAAGCCGAGCAG",
"GGCAGCTGTCGGCAACTGTAAGCCATTTCTGGGACTTTGCTGTGAAAAGCTGGGCGATGGTTGTGGACCTGGACGAGCCACCCGTGCGATAGGTGAGATTCATTCTCGCCCTGACGGGTTGCGTCTGTCATCGGTCGATAAGGACTAACGGCCCTCAGGTGGGGACCAACGCCCCTGGGAGATAGCGGTCCCCGCCAGTAACGTACCGCTGAACCGACGGGATGTATCCGCCCCAGCGAAGGAGACGGCG",
"TCAGCACCATGACCGCCTGGCCACCAATCGCCCGTAACAAGCGGGACGTCCGCGACGACGCGTGCGCTAGCGCCGTGGCGGTGACAACGACCAGATATGGTCCGAGCACGCGGGCGAACCTCGTGTTCTGGCCTCGGCCAGTTGTGTAGAGCTCATCGCTGTCATCGAGCGATATCCGACCACTGATCCAAGTCGGGGGCTCTGGGGACCGAAGTCCCCGGGCTCGGAGCTATCGGACCTCACGATCACC",
]
t = len(Dna)
k = 15
Motifs = GreedyMotifSearch(Dna, k, t)
print(Motifs)
print(Score(Motifs))
#+END_SRC
#+RESULTS:
: ['GTTAGGGCCGGAAGT', 'CCGATCGGCATCACT', 'ACCGTCGATGTGCCC', 'GGGTCAGGTATATTT', 'GTGACCGACGTCCCC', 'CTGTTCGCCGGCAGC', 'CTGTTCGATATCACC', 'GTACATGTCCAGAGC', 'GCGATAGGTGAGATT', 'CTCATCGCTGTCATC']
: 64
Our algorithm is pretty fast, but it's not optimal, and that's just a
characteristic of Greedy Algorithms, they trade optimality for speed.
** Vocabulary
- k-mer: subsquences of length /k/ in a biological sequence
- Frequency map: sequence --> frequency of the sequence