498 lines
18 KiB
Org Mode
498 lines
18 KiB
Org Mode
* Biology Meets Programming: Bioinformatics for Beginners
|
|
|
|
** Week 1
|
|
|
|
*** DNA replication
|
|
|
|
**** Origin of replication (ori)
|
|
|
|
Locating an ori is key for gene therapy (e.g. viral vectors), to introduce a theraupetic gene.
|
|
|
|
**** Computational approaches to find ori in Vibrio Cholerae
|
|
|
|
***** Exercise: find Pattern
|
|
|
|
We'll look for the *DnaA box* sequence, using a sliding window, in that case we will use the function [[./Code/PatternCount.py][PatternCount]] to find out how many times
|
|
does a sequence appear in the genome.
|
|
|
|
For the second part, we're going to calculate the frequency map of the sequences of length /k/, for that purpose we'll use [[./Code/FrequentWords.py][FrequentWords]]
|
|
|
|
***** Exercise: Find the reverse complement of a sequence
|
|
|
|
We're going to generate the reverse complement of a sequence, which is the complement of a sequence, read in the same direction (5' -> 3').
|
|
In this case, we're going to use [[./Code/ReverseComplement.py][ReverseComplement]]
|
|
After using our function on the /Vibrio Cholerae's/ genome, we realize that some of the frequent /k-mers/ are reverse complements of other frequent ones.
|
|
|
|
***** Exercise: Find a subsequence within a sequence
|
|
|
|
We're going to find the ocurrences of a subsquence inside a sequence, and save the index of the first letter in the sequence.
|
|
This time, we'll use [[./Code/PatternMatching.py][PatternMatching]]
|
|
After using our function on the /Vibrio Cholerae's/ genome, we find out that the /9-mers/ with the highest frequency appear in cluster.
|
|
This is strong statistical evidence that our subsequences are /DnaA boxes/.
|
|
|
|
|
|
**** Computational approaches to find ori in any bacteria
|
|
|
|
Now that we're pretty confident about the /DnaA boxes/ sequences that we found, we are going to check if they are a common pattern in the rest of bacterias.
|
|
We're going to find the ocurrences of the sequences in /Thermotoga petrophila/ using [[./Code/PatternCount.py][PatternCount]]
|
|
|
|
After the execution, we observe that there are *no* ocurrences of the sequences found in /Vibrio Cholerae/.
|
|
We can conclude that different bacterias have different /DnaA boxes/.
|
|
|
|
We have to try another computational approach then, find clusters of /k-mers/ repeated in a small interval.
|
|
|
|
|
|
** Week 2
|
|
|
|
*** DNA replication (II)
|
|
|
|
**** Replication process
|
|
|
|
The /DNA polymerases/ start replicating while the parent strands are unraveling.
|
|
On the lagging strand, the DNA polymerase waits until the replication fork opens around 2000 nucleotides, and because of that it forms Okazaki fragments.
|
|
We need 1 primer for the leading strand and 1 primer per Okazaki fragment for the lagging strand.
|
|
While the Okazaki fragments are being synthetized, a /DNA ligase/ starts joining the fragments together.
|
|
|
|
**** Computational approach to find ori using deamination
|
|
|
|
As the lagging strand is always waiting for the helicase to go forward, the lagging strand is mostly in single-stranded configuration, which is more prone to mutations.
|
|
One frequent form of mutation is *deamination*, a process that causes cytosine to convert into thymine. This means that cytosine is more frequent in half of the genome.
|
|
|
|
***** Exercise: count the ocurrences of cytosine
|
|
|
|
We're going to count the ocurrences of the bases in a genome and include them in a symbol array, for that purpose we'll use [[./Code/SymbolArray.py][SymbolArray]]
|
|
After executing the program, we realize that the algorithm is too inefficient.
|
|
|
|
***** Exercise: find a better algorithm for the previous exercise
|
|
|
|
This time, we are going to evaluate an element /i+1/, using the element /i/. We'll use [[./Code/FasterSymbolArray.py][FasterSymbolArray]] to achieve this
|
|
After executing the program we see that it's a viable algorithm, with a complexity of /O(n)/ instead of the previous /O(n²)/.
|
|
In /Escherichia Coli/ we plotted the result of our program:
|
|
|
|
#+CAPTION: Symbol array for Cytosine in E. Coli Genome]
|
|
[[./Assets/e-coli.png]]
|
|
|
|
From that graph, we conclude that ori is located around position 4000000, because that's where the Cytosine concentration is the lowest,
|
|
which indicates that the region stays single-stranded for the longest time.
|
|
|
|
**** The Skew Diagram
|
|
|
|
Usually scientists measure the difference between /G - C/, which is *higher on the lagging strand* and *lower on the leading strand*.
|
|
|
|
***** Exercise: Synthetize a Skew Array
|
|
|
|
We're going to make a Skew Diagram, for that we'll first need a Skew Array. For that purpose we wrote [[./Code/SkewArray.py][SkewArray]]
|
|
We can see the utility of a Skew Diagram looking at the one from /Escherichia Coli/:
|
|
|
|
#+CAPTION: Symbol array for Cytosine in E. Coli Genome]
|
|
[[./Assets/skew_diagram.png]]
|
|
|
|
Ori should be located where the skew is at its minimum value.
|
|
|
|
***** Exercise: Efficient algorithm for locating ori
|
|
|
|
Now that we know more about ori's skew value, we're going to construct a better algorithm to find it. We'll do that in [[./Code/MinimumSkew.py][MinimumSkew]]
|
|
|
|
**** Finding /DnaA boxes/
|
|
|
|
When we look for /DnaA boxes/ in the minimal skew region, we can't find highly repeated /9-mers/ in /Escherichia Coli/.
|
|
But we find approximate sequences that are similar to our /9-mers/ and only differ in 1 nucleotide.
|
|
|
|
***** Exercise: Calculate Hamming distance
|
|
|
|
The Hamming distance is the number of mismatches between 2 strings, we'll solve this problem in [[./Code/HammingDistance][HammingDistance]]
|
|
|
|
***** Exercise: Find approximate patterns
|
|
|
|
Now that we have our Hamming distance, we have to find the approximate sequences. We'll do this in [[./Code/ApproximatePatternMatching.py][ApproximatePatternMatching.py]]
|
|
|
|
***** Exercise: Count the approximate patterns
|
|
|
|
The final part is counting the approximate sequences, for that we'll use [[./Code/ApproximatePatternCount.py][ApproximatePatternCount.py]]
|
|
|
|
After trying out our ApproximatePatternCount in the hypothesized ori region, we find a frequent /k-mer/ with its reverse complement in /Escherichia Coli/.
|
|
We've finally found a computational method to find ori that seems correct.
|
|
|
|
** Week 3
|
|
|
|
*** The circadian clock
|
|
|
|
Variation in gene expression permits the cell to keep track of time.
|
|
|
|
**** Computational approaches to find regulatory motifs
|
|
|
|
***** Exercise: Find the most common nucleotides in each position
|
|
|
|
|
|
We are going to create a *t x k* Motif Matrix, where *t* is the /k-mer/ string. In each position, we'll insert the most frequent nucleotide, in upper case,
|
|
and the nucleotide in lower case (if there's no popular one).
|
|
Our goal is to select the *most* conserved Matrix, i.e. the Matrix with the most upper case letters.
|
|
We'll use a *4 x k* Count Matrix, one row for each base. We'll first generate
|
|
the Matrix:
|
|
|
|
#+BEGIN_SRC python
|
|
def Count(Motifs):
|
|
k = len(Motifs[0])
|
|
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
|
|
t = len(Motifs)
|
|
for i in range(t):
|
|
for j in range(k):
|
|
symbol = Motifs[i][j]
|
|
count[symbol][j] += 1
|
|
return count
|
|
#+END_SRC
|
|
|
|
Now that we have a Count Matrix, we will generate a Profile Matrix, which has
|
|
the frequency of the nucleotide instead of the count:
|
|
|
|
#+BEGIN_SRC python
|
|
def Profile(Motifs):
|
|
t = len(Motifs)
|
|
profile = Count(Motifs)
|
|
for key, v in profile.items():
|
|
v[:] = [x / t for x in v]
|
|
return profile
|
|
|
|
|
|
def Count(Motifs):
|
|
k = len(Motifs[0])
|
|
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
|
|
t = len(Motifs)
|
|
for i in range(t):
|
|
for j in range(k):
|
|
symbol = Motifs[i][j]
|
|
count[symbol][j] += 1
|
|
return count
|
|
#+END_SRC
|
|
|
|
***** Exercise: Form the most frequent sequence of nucleotides
|
|
|
|
Finally, we can form a Consensus string, to get a candidate regulatory motif:
|
|
#+BEGIN_SRC python
|
|
def Consensus(Motifs):
|
|
consensus = ""
|
|
count = Count(Motifs)
|
|
k = len(Motifs[0])
|
|
for j in range(k):
|
|
m = 0
|
|
frequentSymbol = ""
|
|
for symbol in "ACGT":
|
|
if count[symbol][j] > m:
|
|
m = count[symbol][j]
|
|
frequentSymbol = symbol
|
|
consensus += frequentSymbol
|
|
return consensus
|
|
|
|
|
|
def Count(Motifs):
|
|
k = len(Motifs[0])
|
|
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
|
|
t = len(Motifs)
|
|
for i in range(t):
|
|
for j in range(k):
|
|
symbol = Motifs[i][j]
|
|
count[symbol][j] += 1
|
|
return count
|
|
#+END_SRC
|
|
|
|
After obtaining the Consensus string, all we need to do is obtains the total
|
|
score of our selected /k-mers/:
|
|
|
|
#+BEGIN_SRC python
|
|
def Score(Motifs):
|
|
score = 0
|
|
for i in range(len(Motifs)):
|
|
score += HammingDistance(Motifs[i], Consensus(Motifs))
|
|
return score
|
|
|
|
|
|
def Consensus(Motifs):
|
|
consensus = ""
|
|
count = Count(Motifs)
|
|
k = len(Motifs[0])
|
|
for j in range(k):
|
|
m = 0
|
|
frequentSymbol = ""
|
|
for symbol in "ACGT":
|
|
if count[symbol][j] > m:
|
|
m = count[symbol][j]
|
|
frequentSymbol = symbol
|
|
consensus += frequentSymbol
|
|
return consensus
|
|
|
|
|
|
def Count(Motifs):
|
|
k = len(Motifs[0])
|
|
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
|
|
t = len(Motifs)
|
|
for i in range(t):
|
|
for j in range(k):
|
|
symbol = Motifs[i][j]
|
|
count[symbol][j] += 1
|
|
return count
|
|
|
|
|
|
def HammingDistance(p, q):
|
|
count = 0
|
|
for i in range(0, len(p)):
|
|
if p[i] != q[i]:
|
|
count += 1
|
|
return count
|
|
#+END_SRC
|
|
|
|
***** Exercise: Find a set of /k-mers/ that minimize the score
|
|
|
|
|
|
Applying a brute force approach for this task is not viable, we'll use a Greedy Algorithm. For that, we'll first determine the probability
|
|
of a sequence, we'll use:
|
|
|
|
#+BEGIN_SRC python
|
|
def Pr(Text, Profile):
|
|
probability = 1
|
|
k = len(Text)
|
|
for i in range(k):
|
|
probability *= Profile[Text[i]][i]
|
|
return probability
|
|
#+END_SRC
|
|
|
|
We'll use this function to find the most probable /k-mer/ in a sequence:
|
|
|
|
#+BEGIN_SRC python
|
|
def ProfileMostProbableKmer(text, k, profile):
|
|
kmer = ""
|
|
keys = ["A", "C", "G", "T"]
|
|
d = dict(zip(keys,profile))
|
|
prob = -1
|
|
for i in range(len(text)-k+1):
|
|
if (Pr((text[i:i+k]), profile) > prob):
|
|
prob = Pr(text[i:i+k], profile)
|
|
kmer = text[i:i+k]
|
|
return kmer
|
|
|
|
|
|
def Pr(Text, Profile):
|
|
probability = 1
|
|
k = len(Text)
|
|
for i in range(k):
|
|
probability *= Profile[Text[i]][i]
|
|
return probability
|
|
#+END_SRC
|
|
|
|
Now we're finally ready to assemble all the pieces and implement a Greedy Motif
|
|
Search Algorithm:
|
|
|
|
#+BEGIN_SRC python
|
|
def GreedyMotifSearch(Dna, k, t):
|
|
BestMotifs = []
|
|
for i in range(0, t):
|
|
BestMotifs.append(Dna[i][0:k])
|
|
n = len(Dna[0])
|
|
for i in range(n-k+1):
|
|
Motifs = []
|
|
Motifs.append(Dna[0][i:i+k])
|
|
for j in range(1, t):
|
|
P = Profile(Motifs[0:j])
|
|
Motifs.append(ProfileMostProbableKmer(Dna[j], k, P))
|
|
if Score(Motifs) < Score(BestMotifs):
|
|
BestMotifs = Motifs
|
|
return BestMotifs
|
|
|
|
def Score(Motifs):
|
|
score = 0
|
|
for i in range(len(Motifs)):
|
|
score += HammingDistance(Motifs[i], Consensus(Motifs))
|
|
return score
|
|
|
|
|
|
def Consensus(Motifs):
|
|
consensus = ""
|
|
count = Count(Motifs)
|
|
k = len(Motifs[0])
|
|
for j in range(k):
|
|
m = 0
|
|
frequentSymbol = ""
|
|
for symbol in "ACGT":
|
|
if count[symbol][j] > m:
|
|
m = count[symbol][j]
|
|
frequentSymbol = symbol
|
|
consensus += frequentSymbol
|
|
return consensus
|
|
|
|
|
|
def Count(Motifs):
|
|
k = len(Motifs[0])
|
|
count = {'A': [0]*k, 'C': [0]*k, 'G': [0]*k, 'T': [0] * k}
|
|
t = len(Motifs)
|
|
for i in range(t):
|
|
for j in range(k):
|
|
symbol = Motifs[i][j]
|
|
count[symbol][j] += 1
|
|
return count
|
|
|
|
|
|
def HammingDistance(p, q):
|
|
count = 0
|
|
for i in range(0, len(p)):
|
|
if p[i] != q[i]:
|
|
count += 1
|
|
return count
|
|
|
|
|
|
def Profile(Motifs):
|
|
t = len(Motifs)
|
|
profile = Count(Motifs)
|
|
for key, v in profile.items():
|
|
v[:] = [x / t for x in v]
|
|
return profile
|
|
|
|
|
|
def ProfileMostProbableKmer(text, k, profile):
|
|
kmer = ""
|
|
keys = ["A", "C", "G", "T"]
|
|
d = dict(zip(keys,profile))
|
|
prob = -1
|
|
for i in range(len(text)-k+1):
|
|
if (Pr((text[i:i+k]), profile) > prob):
|
|
prob = Pr(text[i:i+k], profile)
|
|
kmer = text[i:i+k]
|
|
return kmer
|
|
|
|
|
|
def Pr(Text, Profile):
|
|
probability = 1
|
|
k = len(Text)
|
|
for i in range(k):
|
|
probability *= Profile[Text[i]][i]
|
|
return probability
|
|
#+END_SRC
|
|
|
|
***** Motifs in tuberculosis
|
|
|
|
Tuberculosis is an infectious disease, cause by a bacteria called /Mycobacterium
|
|
tuberculosis/. The bacteria can stay latent in the host for decades, in hypoxic
|
|
environments.
|
|
Our Greedy Algorithm can help us identify a motif that might be involved in the process.
|
|
|
|
The transcription factor behind this behaviour is *DosR*, we'll identify the
|
|
binding sites:
|
|
|
|
#+BEGIN_SRC python :results output
|
|
def GreedyMotifSearch(Dna, k, t):
|
|
BestMotifs = []
|
|
for i in range(0, t):
|
|
BestMotifs.append(Dna[i][0:k])
|
|
n = len(Dna[0])
|
|
for i in range(n - k + 1):
|
|
Motifs = []
|
|
Motifs.append(Dna[0][i : i + k])
|
|
for j in range(1, t):
|
|
P = Profile(Motifs[0:j])
|
|
Motifs.append(ProfileMostProbableKmer(Dna[j], k, P))
|
|
if Score(Motifs) < Score(BestMotifs):
|
|
BestMotifs = Motifs
|
|
return BestMotifs
|
|
|
|
|
|
def Score(Motifs):
|
|
score = 0
|
|
for i in range(len(Motifs)):
|
|
score += HammingDistance(Motifs[i], Consensus(Motifs))
|
|
return score
|
|
|
|
|
|
def Consensus(Motifs):
|
|
consensus = ""
|
|
count = Count(Motifs)
|
|
k = len(Motifs[0])
|
|
for j in range(k):
|
|
m = 0
|
|
frequentSymbol = ""
|
|
for symbol in "ACGT":
|
|
if count[symbol][j] > m:
|
|
m = count[symbol][j]
|
|
frequentSymbol = symbol
|
|
consensus += frequentSymbol
|
|
return consensus
|
|
|
|
|
|
def Count(Motifs):
|
|
k = len(Motifs[0])
|
|
count = {"A": [0] * k, "C": [0] * k, "G": [0] * k, "T": [0] * k}
|
|
t = len(Motifs)
|
|
for i in range(t):
|
|
for j in range(k):
|
|
symbol = Motifs[i][j]
|
|
count[symbol][j] += 1
|
|
return count
|
|
|
|
|
|
def HammingDistance(p, q):
|
|
count = 0
|
|
for i in range(0, len(p)):
|
|
if p[i] != q[i]:
|
|
count += 1
|
|
return count
|
|
|
|
|
|
def Profile(Motifs):
|
|
t = len(Motifs)
|
|
profile = Count(Motifs)
|
|
for key, v in profile.items():
|
|
v[:] = [x / t for x in v]
|
|
return profile
|
|
|
|
|
|
def ProfileMostProbableKmer(text, k, profile):
|
|
kmer = ""
|
|
keys = ["A", "C", "G", "T"]
|
|
d = dict(zip(keys, profile))
|
|
prob = -1
|
|
for i in range(len(text) - k + 1):
|
|
if Pr((text[i : i + k]), profile) > prob:
|
|
prob = Pr(text[i : i + k], profile)
|
|
kmer = text[i : i + k]
|
|
return kmer
|
|
|
|
|
|
def Pr(Text, Profile):
|
|
probability = 1
|
|
k = len(Text)
|
|
for i in range(k):
|
|
probability *= Profile[Text[i]][i]
|
|
return probability
|
|
|
|
|
|
Dna = [
|
|
"GCGCCCCGCCCGGACAGCCATGCGCTAACCCTGGCTTCGATGGCGCCGGCTCAGTTAGGGCCGGAAGTCCCCAATGTGGCAGACCTTTCGCCCCTGGCGGACGAATGACCCCAGTGGCCGGGACTTCAGGCCCTATCGGAGGGCTCCGGCGCGGTGGTCGGATTTGTCTGTGGAGGTTACACCCCAATCGCAAGGATGCATTATGACCAGCGAGCTGAGCCTGGTCGCCACTGGAAAGGGGAGCAACATC",
|
|
"CCGATCGGCATCACTATCGGTCCTGCGGCCGCCCATAGCGCTATATCCGGCTGGTGAAATCAATTGACAACCTTCGACTTTGAGGTGGCCTACGGCGAGGACAAGCCAGGCAAGCCAGCTGCCTCAACGCGCGCCAGTACGGGTCCATCGACCCGCGGCCCACGGGTCAAACGACCCTAGTGTTCGCTACGACGTGGTCGTACCTTCGGCAGCAGATCAGCAATAGCACCCCGACTCGAGGAGGATCCCG",
|
|
"ACCGTCGATGTGCCCGGTCGCGCCGCGTCCACCTCGGTCATCGACCCCACGATGAGGACGCCATCGGCCGCGACCAAGCCCCGTGAAACTCTGACGGCGTGCTGGCCGGGCTGCGGCACCTGATCACCTTAGGGCACTTGGGCCACCACAACGGGCCGCCGGTCTCGACAGTGGCCACCACCACACAGGTGACTTCCGGCGGGACGTAAGTCCCTAACGCGTCGTTCCGCACGCGGTTAGCTTTGCTGCC",
|
|
"GGGTCAGGTATATTTATCGCACACTTGGGCACATGACACACAAGCGCCAGAATCCCGGACCGAACCGAGCACCGTGGGTGGGCAGCCTCCATACAGCGATGACCTGATCGATCATCGGCCAGGGCGCCGGGCTTCCAACCGTGGCCGTCTCAGTACCCAGCCTCATTGACCCTTCGACGCATCCACTGCGCGTAAGTCGGCTCAACCCTTTCAAACCGCTGGATTACCGACCGCAGAAAGGGGGCAGGAC",
|
|
"GTAGGTCAAACCGGGTGTACATACCCGCTCAATCGCCCAGCACTTCGGGCAGATCACCGGGTTTCCCCGGTATCACCAATACTGCCACCAAACACAGCAGGCGGGAAGGGGCGAAAGTCCCTTATCCGACAATAAAACTTCGCTTGTTCGACGCCCGGTTCACCCGATATGCACGGCGCCCAGCCATTCGTGACCGACGTCCCCAGCCCCAAGGCCGAACGACCCTAGGAGCCACGAGCAATTCACAGCG",
|
|
"CCGCTGGCGACGCTGTTCGCCGGCAGCGTGCGTGACGACTTCGAGCTGCCCGACTACACCTGGTGACCACCGCCGACGGGCACCTCTCCGCCAGGTAGGCACGGTTTGTCGCCGGCAATGTGACCTTTGGGCGCGGTCTTGAGGACCTTCGGCCCCACCCACGAGGCCGCCGCCGGCCGATCGTATGACGTGCAATGTACGCCATAGGGTGCGTGTTACGGCGATTACCTGAAGGCGGCGGTGGTCCGGA",
|
|
"GGCCAACTGCACCGCGCTCTTGATGACATCGGTGGTCACCATGGTGTCCGGCATGATCAACCTCCGCTGTTCGATATCACCCCGATCTTTCTGAACGGCGGTTGGCAGACAACAGGGTCAATGGTCCCCAAGTGGATCACCGACGGGCGCGGACAAATGGCCCGCGCTTCGGGGACTTCTGTCCCTAGCCCTGGCCACGATGGGCTGGTCGGATCAAAGGCATCCGTTTCCATCGATTAGGAGGCATCAA",
|
|
"GTACATGTCCAGAGCGAGCCTCAGCTTCTGCGCAGCGACGGAAACTGCCACACTCAAAGCCTACTGGGCGCACGTGTGGCAACGAGTCGATCCACACGAAATGCCGCCGTTGGGCCGCGGACTAGCCGAATTTTCCGGGTGGTGACACAGCCCACATTTGGCATGGGACTTTCGGCCCTGTCCGCGTCCGTGTCGGCCAGACAAGCTTTGGGCATTGGCCACAATCGGGCCACAATCGAAAGCCGAGCAG",
|
|
"GGCAGCTGTCGGCAACTGTAAGCCATTTCTGGGACTTTGCTGTGAAAAGCTGGGCGATGGTTGTGGACCTGGACGAGCCACCCGTGCGATAGGTGAGATTCATTCTCGCCCTGACGGGTTGCGTCTGTCATCGGTCGATAAGGACTAACGGCCCTCAGGTGGGGACCAACGCCCCTGGGAGATAGCGGTCCCCGCCAGTAACGTACCGCTGAACCGACGGGATGTATCCGCCCCAGCGAAGGAGACGGCG",
|
|
"TCAGCACCATGACCGCCTGGCCACCAATCGCCCGTAACAAGCGGGACGTCCGCGACGACGCGTGCGCTAGCGCCGTGGCGGTGACAACGACCAGATATGGTCCGAGCACGCGGGCGAACCTCGTGTTCTGGCCTCGGCCAGTTGTGTAGAGCTCATCGCTGTCATCGAGCGATATCCGACCACTGATCCAAGTCGGGGGCTCTGGGGACCGAAGTCCCCGGGCTCGGAGCTATCGGACCTCACGATCACC",
|
|
]
|
|
|
|
t = len(Dna)
|
|
k = 15
|
|
|
|
Motifs = GreedyMotifSearch(Dna, k, t)
|
|
|
|
print(Motifs)
|
|
print(Score(Motifs))
|
|
#+END_SRC
|
|
|
|
#+RESULTS:
|
|
: ['GTTAGGGCCGGAAGT', 'CCGATCGGCATCACT', 'ACCGTCGATGTGCCC', 'GGGTCAGGTATATTT', 'GTGACCGACGTCCCC', 'CTGTTCGCCGGCAGC', 'CTGTTCGATATCACC', 'GTACATGTCCAGAGC', 'GCGATAGGTGAGATT', 'CTCATCGCTGTCATC']
|
|
: 64
|
|
|
|
Our algorithm is pretty fast, but it's not optimal, and that's just a
|
|
characteristic of Greedy Algorithms, they trade optimality for speed.
|
|
|
|
|
|
** Vocabulary
|
|
- k-mer: subsquences of length /k/ in a biological sequence
|
|
- Frequency map: sequence --> frequency of the sequence
|